Main Tools
🧬 DNA & RNA Tools 15 tools 🌡️ PCR Tools 14 tools ⚗️ Lab Calculators 14 tools
More Tools
🔬 Protein Tools 12 tools 🦠 Microbiology Tools 12 tools 🧫 Cell Biology Tools 10 tools 📚 Reference Tools 8 tools
ℹ️ About Us Contact Us
📊 GC Content Calculator

GC Content Calculator

Calculate GC percentage and full nucleotide composition of any DNA or RNA sequence. Instant results with visual breakdown.

📊 GC Content Calculator FREE TOOL
0 characters
🧬 DNA Example 🧬 RNA Example 🔴 GC-Rich Example 🔵 AT-Rich Example
Accepts both DNA (ATGC) and RNA (AUGC) — .txt, .fasta, .fa files supported
0%
GC CONTENT
🖨️ Print / Save Result
Nucleotide Composition

Introduction

The GC Content Calculator measures the proportion of guanine and cytosine bases in a DNA or RNA sequence, a property that directly influences melting temperature, primer design, and sequence stability. Molecular biologists, students, and lab researchers use this tool to quickly check whether a sequence falls within an optimal range for PCR, cloning, or sequencing workflows before committing time and reagents to bench work.

About the Tool

GC content is the percentage of nitrogenous bases in a DNA or RNA molecule that are either Guanine (G) or Cytosine (C). It is one of the most important properties of a nucleic acid sequence, and this calculator reports it alongside the full nucleotide breakdown, the AT/GC ratio, and a Peak Local GC value for spotting GC-rich sub-regions within a longer sequence.

The tool automatically detects whether an entered sequence is DNA or RNA, strips FASTA headers and whitespace, and validates that only standard A/T/G/C/U characters are present before calculating — so a pasted sequence, uploaded file, or one of the built-in example sequences all run through the same checks.

Understanding the Inputs

DNA or RNA sequence: Paste or type your sequence into the main field, or use the Upload File button to load a .txt, .fasta, or .fa file. The tool accepts both DNA (A, T, G, C) and RNA (A, U, G, C) sequences and strips any FASTA header line, whitespace, or digits automatically before analysis.

Window Size: Sets the length, in bases, of the sliding window used to scan for the most GC-rich stretch of the sequence. The default of 20 approximates a typical primer length; increase it to scan for larger GC-rich domains, such as CpG islands.

Step Size: Sets how far the sliding window moves between each scan, in bases. A smaller step size checks more positions and gives a more precise Peak Local GC value at the cost of more computation; the default of 5 is a reasonable balance for most sequences.

The GC Content Formula

GC content is calculated by dividing the number of guanine and cytosine bases by the total number of bases in the sequence, then converting to a percentage:

// GC Content Formula:
GC% = (G + C) / Total Bases × 100

// Example: ATGCGATCG (9 bases)
G count = 3, C count = 2
GC% = (3 + 2) / 9 × 100 = 55.6%

The AT/GC Ratio reported in the results is simply the AT (or AU, for RNA) base count divided by the GC base count, giving the same composition information in an alternate form that is convenient for side-by-side sequence comparisons.

Worked Example

Input sequence (27 bases) — Window Size 20, Step Size 5
ATGCGGCATCGGCTAGCTAGCGGATCG
↓ GC% = (G + C) / Total Bases × 100 = (10 + 7) / 27 × 100
Result
GC% = 62.96% · AT/GC Ratio ≈ 0.59 · Peak Local GC ≈ 60.00%

Result Interpretation

The GC% figure is the headline number: it tells you what fraction of your sequence is made of guanine and cytosine bases. A value near 50% is considered balanced and typical of many eukaryotic genes, while values consistently above 60% or below 40% suggest a GC-rich or AT-rich sequence respectively, each with different thermal and structural behavior. The AT/GC Ratio gives the same information in a different form, useful for comparing sequences side by side. The Peak Local GC value shown alongside the overall percentage highlights whether any short stretch of your sequence is markedly more GC-rich than the average — a difference of 15 percentage points or more between the overall GC% and the peak often points to a distinct functional region, such as a CpG island or GC clamp, embedded within the larger sequence.

Practical Applications

Researchers reach for a GC content calculator at several points in a typical molecular biology workflow. Before ordering PCR primers, checking GC content helps confirm the primers will anneal efficiently at a reasonable temperature. When cloning a new insert, GC content can flag regions that may be difficult to amplify or sequence, such as GC-rich promoter regions or AT-rich intergenic regions. Bioinformaticians also use GC content as a quick quality-control step when evaluating assembled contigs, since unusually high or low values compared to the expected organism can indicate contamination or assembly errors. Microbiologists frequently use overall genomic GC content as a taxonomic clue, since it is a relatively stable characteristic within a bacterial species.

Scientific Notes & Limitations

GC content affects many important properties of DNA and RNA including melting temperature, primer design, gene expression, and DNA stability. G-C base pairs form 3 hydrogen bonds while A-T pairs form only 2, making high GC sequences more thermally stable.

GC ContentCategoryCommon Example
20% — 40%Low GCAT-rich regions, TATA box
40% — 60%Normal / BalancedMost mammalian genes
50% — 60%Optimal for PCR primersGood primer GC range
60% — 80%High GCCpG islands, some bacteria
Above 80%Very High GCMycobacterium tuberculosis

Limitations

This calculator reports base composition only — it does not model nearest-neighbor thermodynamics, so it should not be used as a substitute for a dedicated melting-temperature (Tm) calculator when precise annealing temperatures are required. The Peak Local GC value depends on the Window Size and Step Size chosen: a coarse step size can miss a narrow GC-rich region, and a window larger than the sequence itself disables the local scan entirely. IUPAC ambiguity codes (N, R, Y, and similar) are not counted and will trigger an invalid-character warning rather than being estimated or ignored.

Practical Tips

  • When screening candidate PCR primers, aim for the 50–60% GC range and check that GC bases are spread evenly along the primer rather than clustered at one end.
  • Set the Window Size close to your actual primer or probe length so the Peak Local GC value reflects the region you actually care about, rather than a generic default.
  • If Peak Local GC is much higher than the overall GC%, treat that as a signal to inspect the sequence manually for a CpG island or GC clamp before finalizing a primer or cloning strategy.
  • Use the built-in DNA, RNA, GC-rich, and AT-rich example chips to sanity-check how the tool behaves before running your own sequence.
  • For batch or file-based sequences, upload the raw .fasta/.txt file directly — the tool strips headers automatically, so there is no need to pre-clean the file by hand.

Common Mistakes to Avoid

1. Including FASTA headers or non-sequence text in the input — lines starting with ">" or accidental notes pasted alongside the sequence can be misread as bases. This tool strips FASTA headers automatically, but it is good practice to paste only the raw sequence when possible.

2. Mixing DNA and RNA characters — a sequence containing both T and U is not biologically valid and usually indicates a copy-paste error from two different sources. The calculator will reject sequences that mix the two.

3. Using a window size larger than the sequence itself — if your Window Size value exceeds the total sequence length, the local GC scan cannot run and the tool falls back to reporting the overall GC% as the peak value, which is no longer a meaningful local measurement.

4. Ignoring ambiguity codes — sequences from real sequencing data sometimes contain IUPAC ambiguity codes like N, R, or Y. These are not standard A/T/G/C/U bases and will trigger an invalid character warning until they are resolved or removed.

Frequently Asked Questions

What is considered a good GC content for PCR primers?

Most molecular biologists aim for primers with a GC content between 40% and 60%, with 50-60% often cited as the optimal range. This balance gives the primer enough hydrogen bonding from G-C pairs to bind stably to the template while avoiding the secondary structures and non-specific annealing that can occur with very high GC sequences. Primers below 40% GC may have a melting temperature too low for efficient annealing, while primers above 60% GC are more prone to forming hairpins or primer-dimers. When designing primers, it is also useful to check that the GC content is distributed evenly along the primer rather than clustered at one end.

Why does GC content matter for DNA stability and melting temperature?

Guanine and cytosine form three hydrogen bonds when paired, compared to only two hydrogen bonds between adenine and thymine. This extra bond means GC-rich regions of DNA require more thermal energy to denature, directly raising the melting temperature (Tm) of the sequence. In practical terms, a GC-rich PCR template or primer will need a higher annealing or denaturation temperature than an AT-rich one. This relationship is also why GC content is used to estimate Tm in formulas such as the Wallace rule and more advanced nearest-neighbor models.

Does this tool work for both DNA and RNA sequences?

Yes, the calculator automatically detects whether you have entered a DNA sequence (containing thymine, T) or an RNA sequence (containing uracil, U) and adjusts the analysis accordingly. Since uracil replaces thymine in RNA but does not affect the GC count, the GC percentage formula remains the same for both molecule types. The tool will flag an error if a sequence appears to mix both T and U characters, since this normally indicates a data entry mistake rather than a real biological sequence.

What does the Peak Local GC value in my results mean?

Peak Local GC reports the highest GC percentage found within any sliding window of your chosen window size as it moves across the sequence, rather than the average across the whole sequence. This is useful because overall GC content can hide localized GC-rich regions, such as CpG islands or GC clamps, that behave very differently from the rest of the sequence during processes like PCR or restriction digestion. A large gap between your overall GC% and the Peak Local GC value suggests the sequence has uneven GC distribution worth investigating further.

Why is my sequence showing an error about invalid characters?

This error appears when your input contains letters other than A, T, G, C, or U after the tool removes whitespace, numbers, and FASTA header lines starting with a greater-than symbol. Common causes include ambiguity codes such as N, R, or Y from IUPAC nomenclature, accidental inclusion of protein sequence letters, or stray punctuation copied from a document. To resolve this, check your source sequence for non-standard nucleotide codes and either replace them with a specific base or remove the affected region before recalculating.