The Codon Usage Analyzer lets researchers, students, and molecular biologists instantly profile every triplet codon in a DNA coding sequence — grouped by amino acid, with frequency counts, relative usage percentages, and global frequencies. Whether you are planning codon optimization for recombinant protein expression or studying evolutionary codon preferences, this free tool gives you the data you need in seconds.
ATGAAAGCAATTTTCGTATTAAAAGAAATTTGA into the box above (DNA mode, Frame 1, Standard code) and click Analyze Codon Usage.Result: The tool reports 11 complete codons, a start codon (ATG/Met) at position 1, one in-frame stop codon (TGA) at the very end, and a GC content around 21%. Each amino acid section shows how its synonymous codons are distributed — for example, if Ile (ATT) is used instead of the rarer ATA, that's a favorable sign for expression in E. coli.
Why it matters: Spotting rare codons or unexpected internal stop codons before synthesis saves a redesign cycle and avoids truncated protein expression.
| Codon | Amino Acid | 1-Letter | Type |
|---|
How to Use the Codon Usage Analyzer
Step-by-Step Instructions
Step 1 — Enter Your Sequence: Paste your DNA coding sequence into the input box. The sequence should consist of the four standard DNA nucleotides (A, T, G, C). FASTA-formatted sequences are accepted; the tool automatically strips header lines beginning with >. Spaces, numbers, and line breaks are ignored.
Step 2 — Click Analyze: Press the "Analyze Codon Usage" button. The tool scans your sequence from the first base, reads every triplet, and looks up each codon in the standard genetic code table. Processing is instantaneous even for sequences several kilobases in length.
Step 3 — Review Results by Amino Acid: Results are organized into expandable sections, one per amino acid (plus stop codons). Each section lists all synonymous codons observed for that amino acid with their count, relative usage percentage, global sequence percentage, and a visual frequency bar.
Step 4 — Download Your Data: Click the "Download Results" button to save the full codon usage table as a plain-text file. This file is suitable for import into spreadsheet software or further computational analysis.
The Codon Usage Formula
RSCU = (observed codon count) / (total synonymous codon count) × 100
// Global Codon Frequency:
Global % = (codon count / total codons in sequence) × 100
// Example — Leucine (6 synonymous codons):
CTT = 3 times, CTG = 2 times, CTA = 1 time (total Leu = 6)
CTT RSCU = 3/6 × 100 = 50.0%
CTG RSCU = 2/6 × 100 = 33.3%
CTA RSCU = 1/6 × 100 = 16.7%
The RSCU value isolates synonymous codon preference from amino acid composition effects. A codon with RSCU > 1 (or > 100% relative to equal distribution) is used more frequently than expected by chance, indicating positive translational selection or mutational bias in that organism.
When to Use This Calculator
This tool is particularly valuable in the following laboratory and research scenarios:
- Codon optimization for heterologous expression: Before synthesizing or cloning a gene for expression in a different host (e.g., expressing a mammalian gene in E. coli), identify codons that are rare in your target organism and replace them with high-frequency synonymous alternatives to maximize translational efficiency.
- Gene synthesis design verification: After receiving a codon-optimized synthetic gene from a vendor, verify that the delivered sequence actually reflects the intended codon preferences before cloning.
- Evolutionary analysis: Compare codon usage patterns between orthologous genes from different species to study translational selection, mutational bias, and genome compositional pressures.
- mRNA vaccine and therapeutic RNA design: Codon usage influences mRNA stability, secondary structure, and translation rate — all critical parameters in therapeutic RNA design.
- Ribosome stalling investigation: Clusters of rare codons can cause ribosome pausing. Identifying these regions helps explain anomalous protein truncation or low expression levels.
Common Mistakes to Avoid
1. Submitting a non-coding sequence: This tool is designed for coding sequences (CDS) — sequences that are read as triplet codons from start to stop. Submitting UTR regions, intron sequences, or promoter regions will produce meaningless codon data because these are not translated into protein.
2. Ignoring the reading frame: Codon analysis is frame-dependent. Always submit your sequence starting from the first nucleotide of the open reading frame (ATG start codon). If you paste a sequence with upstream non-coding bases, the entire codon grouping will be shifted, producing incorrect amino acid assignments for every codon.
3. Confusing relative usage with absolute frequency: A codon with 90% relative usage simply means it dominates among synonymous alternatives — it says nothing about how common that amino acid itself is in the protein. For overall sequence nucleotide composition, refer to the Global % column instead.
4. Using genomic DNA instead of CDS: If you paste a genomic sequence containing introns, the tool will treat intron sequences as codons. Always use the processed mRNA-derived CDS from a database like NCBI RefSeq or Ensembl.
Interpreting Your Results
Count: The raw number of times a specific codon appears in your submitted sequence. A higher count simply means the codon is more abundant — this is influenced by both codon preference and how frequently that amino acid appears in the protein.
Usage %: The relative synonymous codon usage (RSCU). This shows the codon's preference compared to all other synonymous codons encoding the same amino acid. A value near 100% means this codon is used almost exclusively for that amino acid in this sequence. Values near 0% indicate a rare or avoided codon.
Global %: The codon's contribution to the total codon count in the entire sequence. This reflects overall nucleotide composition effects and is useful for spotting GC-rich or AT-rich codon biases at the whole-sequence level.
Frequency Bar: A visual representation of the usage percentage bar scaled from 0 to 100%, allowing rapid identification of dominant vs. rare synonymous codons at a glance.
What is Codon Usage?
Codon usage refers to how frequently each of the 64 possible codons appears in a DNA sequence. Since most amino acids are encoded by multiple synonymous codons, organisms tend to prefer certain codons over others — this is called codon bias.
Relative Usage = (codon count / total synonymous codons) × 100
// Example — Leucine codons in sequence:
CTT used 3 times, CTC used 1 time, CTG used 2 times
Total Leu codons = 6
CTT usage = 3/6 × 100 = 50%
CTC usage = 1/6 × 100 = 16.7%
CTG usage = 2/6 × 100 = 33.3%
Why Codon Usage Matters
Codon bias affects gene expression, protein folding speed, and is important for codon optimization in recombinant protein production. When expressing a human gene in bacteria for example, you need to optimize codons to match the bacterial codon preference for maximum protein yield.
Frequently Asked Questions
What is codon usage bias and why does it matter in molecular biology?
Codon usage bias refers to the unequal frequency of synonymous codons — different triplet sequences that encode the same amino acid — observed in a genome or gene. This bias varies significantly between organisms and even between different tissues in the same organism. Understanding codon bias is critical for recombinant protein expression, since expressing a human gene in E. coli often yields poor protein if rare bacterial codons are overrepresented. Matching codon usage to the expression host dramatically increases translation efficiency and protein yield. Codon usage data also provides evolutionary insights into translational selection and mutational pressures acting on a genome.
How does the Codon Usage Analyzer calculate usage percentage?
The tool counts every complete triplet codon in your DNA sequence and groups them by the amino acid they encode. For each codon, it calculates relative synonymous codon usage (RSCU): the observed count divided by the total count of all synonymous codons for that amino acid, multiplied by 100. For example, if leucine is encoded 10 times total and CTG appears 4 times, CTG has a usage of 40%. This percentage directly reflects codon preference within the specific gene or sequence you submit, rather than a genome-wide average.
What sequence format should I use as input for the Codon Usage Analyzer?
The analyzer accepts raw DNA sequences using the four standard nucleotide characters: A (adenine), T (thymine), G (guanine), and C (cytosine). You can paste sequences directly in plain text or FASTA format — the tool automatically strips FASTA header lines beginning with the '>' character. Spaces, numbers, and line breaks are also removed automatically. The sequence must be divisible by 3 (complete codons only) for accurate analysis. Sequences containing RNA characters (U instead of T) should be converted to DNA before submission.
How can I use codon usage data for codon optimization?
Codon optimization involves replacing low-frequency (rare) codons in your gene with synonymous codons that are highly used in your target expression host. First, use this analyzer to identify which codons in your gene are rare — those with low usage percentages relative to synonymous alternatives. Then compare these against the codon usage table of your host organism (e.g., E. coli K-12, CHO cells, Saccharomyces cerevisiae). Replace rare codons with the preferred synonymous codon while maintaining the same amino acid sequence. This process significantly improves mRNA stability and ribosome speed, leading to higher protein expression levels.
What does the Global % column represent in the codon usage results table?
The Global % column shows what fraction of all codons in the entire input sequence is accounted for by that particular codon, regardless of amino acid. It is calculated as: (codon count / total codons in sequence) × 100. This metric differs from the usage percentage, which is calculated relative to synonymous codons only. The global frequency is useful for understanding the overall nucleotide composition contribution of each codon. For example, a high global frequency for GC-rich codons indicates an overall high GC content in the coding sequence, which can affect mRNA secondary structure and stability.