Main Tools
🧬 DNA & RNA Tools 15 tools 🌡️ PCR Tools 14 tools ⚗️ Lab Calculators 14 tools
More Tools
🔬 Protein Tools 12 tools 🦠 Microbiology Tools 12 tools 🧫 Cell Biology Tools 10 tools 📚 Reference Tools 8 tools
ℹ️ About Us Contact Us
🔬 DNA to Protein Translator

DNA to Protein Translator

Translate any DNA coding sequence to amino acid protein sequence using the standard genetic code. Shows single letter, three letter codes and full codon table.

The DNA to Protein Translator converts any DNA coding sequence into its corresponding amino acid chain using the universal standard genetic code. Used by molecular biologists, biochemists, and students for gene annotation, protein expression planning, and sequence verification, this free online tool provides instant results in both single-letter and three-letter amino acid formats alongside a full codon breakdown table.

🔬 DNA to Protein Translator FREE TOOL
0 valid bases
If your sequence is mRNA, select RNA and any U bases will be automatically treated as T before translation.
Accepts .txt, .fasta, .fa files — uses standard genetic code
✅ Protein Sequence (Single Letter)
✅ Protein Sequence (Three Letter)
Codon Translation Table
📋 See a Worked Example ▾

Scenario: You've just received a synthesized 30 bp insert from a gene supplier and want to confirm it will express the correct short peptide before cloning it into your expression vector.

Inputs: Sequence: ATGAAAGCAATTTTCGTATTAAAAGGATGA, Reading Frame: +1, Output Format: Both.

Result: The tool reads 10 complete codons and stops at the TGA stop codon, returning the protein MKAIFVLKG* (Met-Lys-Ala-Ile-Phe-Val-Leu-Lys-Gly-Stop) — a 9-residue peptide.

Because translation starts cleanly at ATG and terminates at an in-frame stop codon, this confirms the insert is in the correct reading frame with no frameshift — safe to proceed with cloning into the expression vector.

Reference: Standard Genetic Code Table

How to Use the DNA to Protein Translator

This free online tool translates any DNA coding sequence into its amino acid protein sequence using the universal standard genetic code. Follow the steps below to get accurate results for your research or coursework.

Step-by-Step Instructions

Step 1 — Enter your DNA sequence: Paste or type your DNA coding sequence into the input textarea. The sequence should use only the four standard DNA bases: A (adenine), T (thymine), G (guanine), and C (cytosine). Lowercase letters, spaces, and line breaks are automatically removed. FASTA-format sequences (with a header line starting with >) are also accepted — the header will be stripped automatically.

Step 2 — Select the reading frame: Choose Frame +1 if your sequence starts directly with the ATG start codon, which is the most common scenario for cloned coding sequences and cDNA. Select Frame +2 or Frame +3 if you are working with a genomic fragment where the open reading frame begins at a different position. When in doubt, try all three frames and identify which one produces a protein beginning with Methionine.

Step 3 — Choose the output format: Select Single Letter Code (M, A, K…) for compact FASTA-compatible output, Three Letter Code (Met-Ala-Lys…) for more readable results in reports and publications, or Both to display both formats simultaneously.

Step 4 — Click Translate to Protein: The tool reads the sequence codon by codon, looks up each triplet in the standard genetic code table, and outputs the corresponding amino acids. Translation halts automatically at the first stop codon (TAA, TAG, or TGA). The codon breakdown table below the results shows each individual codon and its corresponding amino acid.

Step 5 — Review and copy your results: Use the Copy button next to each output format to copy the protein sequence to your clipboard. Sequence statistics including DNA length, number of codons, protein length, and presence of start and stop codons are shown above the output.

The Genetic Code — How Translation Works

The genetic code is the set of rules by which information encoded in DNA is translated into protein. DNA is read in non-overlapping triplets of nucleotides called codons. With four possible bases (A, T, G, C) and three positions per codon, there are 4³ = 64 possible codons. These 64 codons map to 20 standard amino acids plus three stop signals, making the code redundant (also called degenerate) — most amino acids are encoded by more than one codon.

// Codon → Amino Acid mapping example:
DNA 5'→3': ATG — AAA — GCA — ATT — TGA
              ↓     ↓     ↓     ↓     ↓
Protein:   Met — Lys — Ala — Ile — Stop
1-letter:  M     K     A     I     *

// Start codon: ATG = Methionine (M)
// Stop codons: TAA (Ochre), TAG (Amber), TGA (Opal)

Stop Codons

There are three stop codons in the standard genetic code — TAA (Ochre), TAG (Amber), and TGA (Opal). When the ribosome encounters any of these codons, translation terminates and the completed polypeptide is released from the ribosome. In this tool, stop codons are highlighted in red and displayed as an asterisk (*) in single-letter mode or as "Stop" in three-letter mode.

Reading Frames

Any double-stranded DNA sequence can be read in six different reading frames — three on the forward strand (+1, +2, +3) and three on the reverse complement strand (−1, −2, −3). The biologically correct reading frame is the one that begins with an ATG start codon and contains the open reading frame (ORF) encoding the full protein without internal stop codons. This tool handles the three forward reading frames. Use the ORF Finder tool to identify all possible reading frames in an unknown sequence.

When to Use This Calculator

Use this tool when you need to quickly verify the protein product encoded by a DNA sequence you have designed or retrieved from a database. Common lab scenarios include: confirming that a PCR-amplified insert is in-frame after cloning into an expression vector; checking that a gene synthesis order will produce the intended protein sequence; translating a CDS (coding sequence) entry from NCBI GenBank; predicting the effect of a point mutation or frameshift on the resulting protein; and annotating ORFs identified by a genome assembly pipeline.

Common Mistakes to Avoid

1. Off-by-one frameshift errors: If your sequence has extra nucleotides at the 5′ end — such as restriction site overhangs or vector-derived bases — your reading frame will be shifted. Always trim the sequence to begin exactly at the ATG start codon before using Frame +1, or select the appropriate offset frame to compensate.

2. Submitting RNA sequences directly: This tool expects DNA (using T, not U). If you paste an mRNA sequence containing uracil (U), those bases will be removed as invalid characters, corrupting the sequence. Replace all U with T before translating RNA sequences.

3. Forgetting that the result is a precursor protein: The translated sequence includes the start Methionine and may include signal peptides or propeptide regions that are cleaved after translation. The mature, functional protein may be shorter than the raw translation output. Always cross-reference with protein databases such as UniProt for post-translational processing information.

Interpreting Your Results

The output displays your protein sequence with the start codon Methionine highlighted in green and the stop codon in red. The statistics panel shows the total DNA length in base pairs, the number of complete codons read, the number of amino acids in the protein (excluding the stop codon), and whether a canonical start codon (ATG) and stop codon were detected. If no stop codon is found, the translation continues to the end of the input sequence and a warning is shown. This may indicate that your sequence is truncated or that you need to check the reading frame.

Frequently Asked Questions

What is a DNA to protein translator and how does it work?

A DNA to protein translator converts a DNA coding sequence into its corresponding amino acid (protein) sequence using the standard genetic code. The tool reads the DNA sequence in triplets called codons — groups of three nucleotides. Each codon maps to a specific amino acid according to the universal genetic code table. Translation begins at the ATG start codon (which codes for Methionine) and continues until a stop codon (TAA, TAG, or TGA) is encountered. The result is a chain of amino acids representing the primary structure of the encoded protein.

What reading frame should I choose when translating a DNA sequence?

The reading frame determines which nucleotide position translation begins from. Frame +1 starts at the very first base of your input sequence and is the correct choice when your sequence already begins with the ATG start codon. Frame +2 introduces an offset of one nucleotide (skipping the first base), and Frame +3 skips two bases. In most cloning and gene expression contexts you will use Frame +1. However, if your sequence is a genomic fragment or intergenic region where the ORF does not begin at position 1, you may need to try all three frames to identify the correct open reading frame.

What are stop codons and what happens when the translator encounters one?

Stop codons are special triplets in the genetic code that signal the end of a protein-coding sequence. The three stop codons in the standard genetic code are TAA (called Ochre), TAG (Amber), and TGA (Opal). These codons do not encode any amino acid — instead, they are recognized by release factors in the ribosome that trigger termination of translation. In this DNA to protein translator, when a stop codon is encountered the output sequence ends at that position. The stop codon is displayed as an asterisk (*) in single-letter format or as "Stop" in three-letter format, and it is visually highlighted in red in the output.

Why does my translated protein sequence show a question mark (?)?

A question mark in the translated output appears when a codon in your DNA sequence cannot be found in the standard genetic code table — typically because the codon contains an ambiguous or non-standard nucleotide. The standard genetic code only uses the four canonical DNA bases: A (adenine), T (thymine), G (guanine), and C (cytosine). If your input contains IUPAC ambiguity codes (such as N, R, Y, W, S, M, K, B, D, H, or V) these will be filtered out during input cleaning, which may shift the reading frame and produce unexpected codons. Ensure your input sequence contains only A, T, G, and C for accurate translation results.

Can I use this tool to translate RNA sequences or only DNA?

This tool is designed to translate DNA sequences that use thymine (T) as the fourth nucleotide base. However, you can easily adapt an RNA sequence for use with this tool by replacing all uracil (U) bases with thymine (T) before pasting the sequence, since T and U are functionally equivalent in this context — both pair with adenine and both are decoded by the ribosome in the same way. The standard genetic code is identical whether you use a DNA or mRNA reference. If you frequently work with RNA sequences, the BioToolsKit also provides a dedicated DNA to RNA Converter tool.