The DNA Molecular Weight Calculator lets you instantly determine the mass of any DNA sequence in grams per mole (g/mol) and kilodaltons (kDa). Widely used by molecular biologists, biochemists, and graduate researchers, this free online tool supports both single-stranded and double-stranded DNA and accounts for phosphodiester bond water losses for accurate results.
Scenario: You've synthesized a 20 nt forward primer, 5'-ATGCGATCGATCGATCGATC-3', and need its molecular weight to convert a NanoDrop mass reading into a molar concentration for a PCR reaction.
Inputs used: Sequence = ATGCGATCGATCGATCGATC (20 bases) · Strand Type = Single Stranded (ssDNA) · End Type = 5' Phosphate (standard for synthesized oligos).
Result: Total MW ≈ 6,196.87 g/mol (6.20 kDa), calculated as the sum of 5 dAMP + 5 dTMP + 5 dGMP + 5 dCMP residues minus 19 × 18.02 g/mol for the phosphodiester bonds formed.
Why it matters: Knowing the exact MW lets you convert a 500 ng/µL stock into a precise molar concentration (µM), which is essential for pipetting the correct primer amount into a PCR master mix without over- or under-shooting the recommended 0.1–0.5 µM final concentration.
How to Use the DNA Molecular Weight Calculator
Step-by-Step Instructions
Step 1 — Enter your DNA sequence: Paste or type your DNA sequence directly into the text area. The calculator accepts raw sequences as well as FASTA-format input — FASTA header lines beginning with ">" are automatically removed. Spaces, line breaks, and numerals are stripped out so you can paste sequences copied directly from databases such as NCBI, Ensembl, or SnapGene without cleaning them up first.
Step 2 — Select Strand Type: Choose Single Stranded (ssDNA) if you are working with a synthetic oligonucleotide, a primer, an antisense probe, or any other molecule that exists as an unpaired strand. Choose Double Stranded (dsDNA) for PCR products, restriction fragments, plasmid inserts, or any fully duplexed DNA. When dsDNA is selected, the calculator automatically derives the complementary strand using Watson-Crick base pairing (A↔T, G↔C) and sums both strand masses.
Step 3 — Select End Type: Choose 5' Phosphate (the default) for most laboratory DNA. This applies to nucleotide residues that retain their 5'-phosphate group, which is the case for the majority of biological and chemically synthesized DNA. Choose 5' Hydroxyl if your sequence was generated by PCR without a 5'-phosphorylated primer, or if you are working with DNA that has been dephosphorylated using calf intestinal phosphatase (CIP) or similar enzymes.
Step 4 — Click Calculate MW: The result is displayed instantly, showing the total molecular weight in g/mol, the equivalent in kilodaltons (kDa), and a nucleotide-by-nucleotide breakdown of each base's contribution to the total mass.
The Molecular Weight Formula Explained
The calculator uses average (not monoisotopic) molecular weights, which is the appropriate value for most laboratory contexts. The formula for a single-stranded DNA with a 5'-phosphate terminus is:
// Where n = total sequence length, and nA, nT, nG, nC are base counts
// The (n − 1) × 18.02 term accounts for water lost during phosphodiester bond formation
For dsDNA: MWdsDNA = MWsense + MWcomplement
The individual nucleotide weights used (5'-phosphate) are: dAMP = 331.22 g/mol, dTMP = 322.21 g/mol, dGMP = 347.22 g/mol, and dCMP = 307.20 g/mol. For 5'-hydroxyl sequences, the corresponding values are: dA = 251.24, dT = 242.23, dG = 267.24, dC = 227.22 g/mol.
When to Use This Calculator
This tool is most useful in the following common laboratory scenarios:
- Oligonucleotide stock preparation: Converting an OD260 absorbance reading to a molar concentration (nmol/μL) requires knowing the exact molecular weight of your oligo.
- Ligation reactions: Calculating molar ratios of vector to insert requires converting ng measurements to picomoles using each fragment's molecular weight.
- NGS library preparation: Accurate molar quantification of DNA libraries before sequencing depends on correct MW-based conversions.
- Copy number calculations: Determining the number of DNA molecules per microgram is a direct application of molecular weight and Avogadro's number.
- CRISPR gRNA assembly: Calculating molar equivalents of guide RNA to Cas9 protein requires mass-to-mole conversion using molecular weight.
Common Mistakes to Avoid
1. Choosing the wrong strand type: Entering a single primer sequence but selecting dsDNA mode will double-count the mass by adding a synthesized complement that does not exist in your experiment. Always match the strand type to the actual physical state of your DNA.
2. Ignoring the end type: For short oligonucleotides (under 30 nt), the 5'-phosphate vs. 5'-hydroxyl distinction makes a meaningful difference — approximately 80 g/mol per strand. Always confirm whether your oligo was synthesized with or without a 5'-phosphate, especially when ordering custom primers.
3. Using molecular weight for RNA sequences: DNA and RNA have different nucleotide residue weights (RNA uses uracil instead of thymine, and the 2'-OH group adds to each residue mass). Use this tool only for DNA sequences. For RNA, use the dedicated RNA Molecular Weight Calculator available on BioToolsKit.
Interpreting Your Results
The primary output is the total molecular weight in g/mol, which is numerically equivalent to Daltons (Da). For convenience, the result is also shown in kilodaltons (kDa) — divide g/mol by 1,000. The breakdown table shows each base's individual contribution, the number of water molecules lost, and for dsDNA, the complement strand's contribution. These values can be cross-checked manually against published tables to verify accuracy. If your sequence is very short (under 5 bases), double-check the end type, as the terminal group mass is a large proportion of the total.
How DNA Molecular Weight is Calculated
The molecular weight of a DNA sequence is calculated by summing the molecular weights of all individual nucleotides and subtracting water molecules lost during phosphodiester bond formation.
dAMP (Adenine) = 331.22 g/mol
dTMP (Thymine) = 322.21 g/mol
dGMP (Guanine) = 347.22 g/mol
dCMP (Cytosine) = 307.20 g/mol
// Formula for ssDNA:
MW = (nA × 331.22) + (nT × 322.21) +
(nG × 347.22) + (nC × 307.20) - 61.96
// For dsDNA — add complement strand MW
Reference Molecular Weights
| Nucleotide | Base | MW (5' Phosphate) g/mol | MW (5' OH) g/mol |
|---|---|---|---|
| dAMP | Adenine | 331.22 | 251.24 |
| dTMP | Thymine | 322.21 | 242.23 |
| dGMP | Guanine | 347.22 | 267.24 |
| dCMP | Cytosine | 307.20 | 227.22 |
Quick Average-Weight Estimates
When an exact sequence isn't available (e.g. estimating a plasmid or a genomic fragment by length alone), these commonly used average weights give a fast approximation. This calculator always uses the exact per-base sum above — the values below are for quick mental math only.
| DNA Type | Average MW | Typical Use |
|---|---|---|
| ssDNA (per nt) | ~330 g/mol | Quick oligo MW estimate |
| dsDNA (per bp) | ~650 g/mol | Quick PCR product / plasmid estimate |
| 1 kb dsDNA | ~650,000 g/mol (650 kDa) | Gel/ladder sizing reference |
| Average dsDNA plasmid (3 kb) | ~1.95 × 10⁶ g/mol | Cloning vector estimate |
Frequently Asked Questions
How is DNA molecular weight calculated?
DNA molecular weight is calculated by summing the average molecular weights of all individual nucleotide monophosphates in the sequence, then subtracting 18.02 g/mol for each phosphodiester bond formed (n−1 bonds for n nucleotides). For 5'-phosphate DNA, the standard residue weights are: dAMP = 331.22 g/mol, dTMP = 322.21 g/mol, dGMP = 347.22 g/mol, and dCMP = 307.20 g/mol. For double-stranded DNA, the complementary strand MW is calculated separately and added to the sense strand total. This approach gives the average molecular weight, which accounts for the natural isotopic distribution of elements and is the most practically useful value for laboratory work.
What is the difference between 5' phosphate and 5' hydroxyl end types?
The 5' end type determines whether the terminal nucleotide carries a phosphate group (5'-phosphate) or a free hydroxyl group (5'-OH). Most biologically derived and commercially synthesized DNA oligonucleotides have a 5'-phosphate by default, which adds approximately 79.98 g/mol to the overall molecular weight. PCR products typically have 5'-hydroxyl ends generated by the polymerase unless a 5'-phosphorylated primer is used. Choosing the correct end type is important for accurate molecular weight calculations, particularly for short oligonucleotides where the terminal group represents a significant fraction of total mass.
Why does the calculator subtract water molecules from the total?
During DNA synthesis, each nucleotide is joined to the growing chain through a condensation reaction that forms a phosphodiester bond between the 3'-hydroxyl of one nucleotide and the 5'-phosphate of the next. This reaction releases one water molecule (18.02 g/mol) per bond formed. For a sequence of n nucleotides, there are n−1 such bonds, so the calculator subtracts (n−1) × 18.02 g/mol from the summed individual nucleotide weights. Failing to account for this water loss would significantly overestimate the molecular weight of longer sequences — for example, a 100 bp strand would be overestimated by approximately 1,782 g/mol without this correction.
When should I use single-stranded versus double-stranded mode?
Choose single-stranded (ssDNA) mode when working with synthetic oligonucleotides, primers, probes, or any DNA molecule that exists as an unpaired single strand in your experiment. Use double-stranded (dsDNA) mode for genomic DNA fragments, PCR products, plasmid linearization products, restriction enzyme digestion fragments, or any fully duplexed DNA molecule. The dsDNA calculation automatically generates the complementary strand based on Watson-Crick base pairing rules (A↔T, G↔C) and sums both strand masses. If you have already entered only one strand of a duplex and need the full dsDNA mass, select double-stranded mode — the calculator will handle the complement for you.
What is the practical use of knowing DNA molecular weight in the lab?
DNA molecular weight is a foundational parameter in multiple molecular biology applications. It is essential for converting between molar concentrations (nmol/L) and mass concentrations (ng/μL or μg/mL) when preparing working stocks of oligonucleotides, plasmids, or PCR products. It is also critical for calculating copy number from a DNA mass measurement using spectrophotometry, for designing accurate molar ratio experiments such as ligation reactions (vector:insert ratios) and CRISPR ribonucleoprotein assembly, and for estimating migration behavior on agarose gels. Researchers in next-generation sequencing library preparation rely on accurate DNA mass-to-mole conversions to achieve proper cluster densities.