Main Tools
🧬 DNA Tools 15 tools 🌡️ PCR Tools 14 tools ⚗️ Lab Calculators 14 tools
More Tools
🔬 Protein Tools 12 tools 🦠 Microbiology Tools 12 tools 🧫 Cell Biology Tools 10 tools 📚 Reference Tools 8 tools
ℹ️ About Us Contact Us
⚗️ DNA Molecular Weight Calculator

DNA Molecular Weight Calculator

Calculate the molecular weight of any DNA sequence in g/mol using standard nucleotide molecular weights. Single and double stranded calculations included.

⚗️ DNA Molecular Weight Calculator FREE TOOL
0 valid bases
Accepts .txt, .fasta, .fa files — FASTA headers removed automatically
0
g/mol (Daltons)
0 kDa
Kilodaltons
0 bp
Sequence Length
dsDNA
Strand Type
Nucleotide Contribution Breakdown

Introduction

The DNA Molecular Weight Calculator lets you instantly determine the mass of any DNA sequence in grams per mole (g/mol) and kilodaltons (kDa). Widely used by molecular biologists, biochemists, and graduate researchers, this free online tool supports both single-stranded and double-stranded DNA and accounts for phosphodiester bond water losses for accurate results.

About the Tool

This calculator determines the molecular weight of a DNA sequence you enter directly, in a FASTA file, or from one of three built-in presets (a 20 nt ssDNA primer, a 50 bp dsDNA fragment, and a GC-rich 30 nt oligo). It handles both single-stranded and double-stranded DNA, lets you choose between a 5'-phosphate or 5'-hydroxyl terminus, and returns the total weight in g/mol and kDa alongside a full per-base contribution breakdown, a substituted formula showing the exact numbers used, and a plain-English interpretation of the result. Results can be copied to the clipboard or printed for lab notebooks and records.

Input Explanation

Sequence: Paste or type your DNA sequence directly into the text area. The calculator accepts raw sequences as well as FASTA-format input — header lines beginning with ">" are automatically removed. Spaces, line breaks, and numerals are stripped out so you can paste sequences copied directly from databases such as NCBI, Ensembl, or SnapGene without cleaning them up first.

Strand Type: Choose Single Stranded (ssDNA) if you are working with a synthetic oligonucleotide, a primer, an antisense probe, or any other molecule that exists as an unpaired strand. Choose Double Stranded (dsDNA) for PCR products, restriction fragments, plasmid inserts, or any fully duplexed DNA. When dsDNA is selected, the calculator automatically derives the complementary strand using Watson-Crick base pairing (A↔T, G↔C) and sums both strand masses.

End Type: Choose 5' Phosphate (the default) for most laboratory DNA — this applies to nucleotide residues that retain their 5'-phosphate group, which is the case for the majority of biological and chemically synthesized DNA. Choose 5' Hydroxyl if your sequence was generated by PCR without a 5'-phosphorylated primer, or if it has been dephosphorylated using calf intestinal phosphatase (CIP) or a similar enzyme.

Formula Explanation

The calculator uses average (not monoisotopic) molecular weights, which is the appropriate value for most laboratory contexts. The formula for a single-stranded DNA with a 5'-phosphate terminus is:

MWssDNA = (nA × 331.22) + (nT × 322.21) + (nG × 347.22) + (nC × 307.20) − (n − 1) × 18.02

// Where n = total sequence length, and nA, nT, nG, nC are base counts
// The (n − 1) × 18.02 term accounts for water lost during phosphodiester bond formation

For dsDNA: MWdsDNA = MWsense + MWcomplement

Reference Molecular Weights

NucleotideBaseMW (5' Phosphate) g/molMW (5' OH) g/mol
dAMPAdenine331.22251.24
dTMPThymine322.21242.23
dGMPGuanine347.22267.24
dCMPCytosine307.20227.22

Worked Example

📋 See a Worked Example ▾

Scenario: You've synthesized a 20 nt forward primer, 5'-ATGCGATCGATCGATCGATC-3', and need its molecular weight to convert a NanoDrop mass reading into a molar concentration for a PCR reaction.

Inputs used: Sequence = ATGCGATCGATCGATCGATC (20 bases) · Strand Type = Single Stranded (ssDNA) · End Type = 5' Phosphate (standard for synthesized oligos).

Result: Total MW ≈ 6,196.87 g/mol (6.20 kDa), calculated as the sum of 5 dAMP + 5 dTMP + 5 dGMP + 5 dCMP residues minus 19 × 18.02 g/mol for the phosphodiester bonds formed.

Why it matters: Knowing the exact MW lets you convert a 500 ng/µL stock into a precise molar concentration (µM), which is essential for pipetting the correct primer amount into a PCR master mix without over- or under-shooting the recommended 0.1–0.5 µM final concentration.

Result Interpretation

The primary output is the total molecular weight in g/mol, which is numerically equivalent to Daltons (Da). For convenience, the result is also shown in kilodaltons (kDa) — divide g/mol by 1,000. The breakdown table shows each base's individual contribution, the number of water molecules lost, and for dsDNA, the complement strand's contribution. These values can be cross-checked manually against published tables to verify accuracy. If your sequence is very short (under 5 bases), double-check the end type, as the terminal group mass is a large proportion of the total.

Practical Applications

This tool is most useful in the following common laboratory scenarios:

  • Oligonucleotide stock preparation: Converting an OD260 absorbance reading to a molar concentration (nmol/μL) requires knowing the exact molecular weight of your oligo.
  • Ligation reactions: Calculating molar ratios of vector to insert requires converting ng measurements to picomoles using each fragment's molecular weight.
  • NGS library preparation: Accurate molar quantification of DNA libraries before sequencing depends on correct MW-based conversions.
  • Copy number calculations: Determining the number of DNA molecules per microgram is a direct application of molecular weight and Avogadro's number.
  • CRISPR gRNA assembly: Calculating molar equivalents of guide RNA to Cas9 protein requires mass-to-mole conversion using molecular weight.

Scientific Notes & Limitations

This calculator reports average molecular weight, not monoisotopic mass. Average MW accounts for the natural isotopic distribution of each element and is the value used in nearly all routine laboratory calculations (concentration conversions, molar ratios, etc.); monoisotopic mass is a separate value used in mass spectrometry work and is outside the scope of this tool.

The formula and nucleotide weights used here apply to DNA only. RNA has different residue weights (uracil instead of thymine, plus a 2'-OH group on the ribose), so this tool should not be used for RNA sequences — use the dedicated RNA Molecular Weight Calculator instead.

For sequences longer than roughly 50,000 bases, an exact per-base sum is still calculated, but it may be more practical to work from an average bp-weight estimate. The commonly used approximations below are for quick mental math only — this calculator always uses the exact per-base sum from the Formula Explanation above.

DNA TypeAverage MWTypical Use
ssDNA (per nt)~330 g/molQuick oligo MW estimate
dsDNA (per bp)~650 g/molQuick PCR product / plasmid estimate
1 kb dsDNA~650,000 g/mol (650 kDa)Gel/ladder sizing reference
Average dsDNA plasmid (3 kb)~1.95 × 10⁶ g/molCloning vector estimate

Practical Tips

  • Match strand type to physical reality: Only select dsDNA mode if your sample genuinely exists as a duplex in the tube — the calculator will otherwise add a complementary strand that doesn't exist in your sample.
  • Confirm the 5' end before ordering or quantifying: Check your primer order confirmation or synthesis report for phosphorylation status, especially for short oligos where the terminal group is a larger fraction of total mass.
  • Use the presets to sanity-check the tool: Load the built-in 20 nt primer example and compare it against the Worked Example above to confirm the calculator is behaving as expected before relying on it for a real sample.
  • Cross-check the breakdown table: If a result looks off, the per-base contribution table makes it easy to spot whether a base count or the water-loss term is driving the discrepancy.

Common Mistakes

1. Choosing the wrong strand type: Entering a single primer sequence but selecting dsDNA mode will double-count the mass by adding a synthesized complement that does not exist in your experiment.

2. Ignoring the end type: For short oligonucleotides (under 30 nt), the 5'-phosphate vs. 5'-hydroxyl distinction makes a meaningful difference — approximately 80 g/mol per strand.

3. Using this calculator for RNA sequences: DNA and RNA nucleotide residues have different weights, so entering an RNA sequence here will give an incorrect result — use the dedicated RNA Molecular Weight Calculator instead.

Frequently Asked Questions

How is DNA molecular weight calculated?

DNA molecular weight is calculated by summing the average molecular weights of all individual nucleotide monophosphates in the sequence, then subtracting 18.02 g/mol for each phosphodiester bond formed (n−1 bonds for n nucleotides). For 5'-phosphate DNA, the standard residue weights are: dAMP = 331.22 g/mol, dTMP = 322.21 g/mol, dGMP = 347.22 g/mol, and dCMP = 307.20 g/mol. For double-stranded DNA, the complementary strand MW is calculated separately and added to the sense strand total. This approach gives the average molecular weight, which accounts for the natural isotopic distribution of elements and is the most practically useful value for laboratory work.

What is the difference between 5' phosphate and 5' hydroxyl end types?

The 5' end type determines whether the terminal nucleotide carries a phosphate group (5'-phosphate) or a free hydroxyl group (5'-OH). Most biologically derived and commercially synthesized DNA oligonucleotides have a 5'-phosphate by default, which adds approximately 79.98 g/mol to the overall molecular weight. PCR products typically have 5'-hydroxyl ends generated by the polymerase unless a 5'-phosphorylated primer is used. Choosing the correct end type is important for accurate molecular weight calculations, particularly for short oligonucleotides where the terminal group represents a significant fraction of total mass.

Why does the calculator subtract water molecules from the total?

During DNA synthesis, each nucleotide is joined to the growing chain through a condensation reaction that forms a phosphodiester bond between the 3'-hydroxyl of one nucleotide and the 5'-phosphate of the next. This reaction releases one water molecule (18.02 g/mol) per bond formed. For a sequence of n nucleotides, there are n−1 such bonds, so the calculator subtracts (n−1) × 18.02 g/mol from the summed individual nucleotide weights. Failing to account for this water loss would significantly overestimate the molecular weight of longer sequences — for example, a 100 bp strand would be overestimated by approximately 1,782 g/mol without this correction.

When should I use single-stranded versus double-stranded mode?

Choose single-stranded (ssDNA) mode when working with synthetic oligonucleotides, primers, probes, or any DNA molecule that exists as an unpaired single strand in your experiment. Use double-stranded (dsDNA) mode for genomic DNA fragments, PCR products, plasmid linearization products, restriction enzyme digestion fragments, or any fully duplexed DNA molecule. The dsDNA calculation automatically generates the complementary strand based on Watson-Crick base pairing rules (A↔T, G↔C) and sums both strand masses. If you have already entered only one strand of a duplex and need the full dsDNA mass, select double-stranded mode — the calculator will handle the complement for you.

What is the practical use of knowing DNA molecular weight in the lab?

DNA molecular weight is a foundational parameter in multiple molecular biology applications. It is essential for converting between molar concentrations (nmol/L) and mass concentrations (ng/μL or μg/mL) when preparing working stocks of oligonucleotides, plasmids, or PCR products. It is also critical for calculating copy number from a DNA mass measurement using spectrophotometry, for designing accurate molar ratio experiments such as ligation reactions (vector:insert ratios) and CRISPR ribonucleoprotein assembly, and for estimating migration behavior on agarose gels. Researchers in next-generation sequencing library preparation rely on accurate DNA mass-to-mole conversions to achieve proper cluster densities.