Main Tools
🧬 DNA & RNA Tools 15 tools 🌡️ PCR Tools 14 tools ⚗️ Lab Calculators 14 tools
More Tools
🔬 Protein Tools 12 tools 🦠 Microbiology Tools 12 tools 🧫 Cell Biology Tools 10 tools 📚 Reference Tools 8 tools
ℹ️ About Us Contact Us
🧪 RNA Molecular Weight Calculator

RNA Molecular Weight Calculator

Calculate the molecular weight of any RNA sequence in g/mol using standard nucleotide molecular weights. Single and double stranded RNA calculations included.

The RNA Molecular Weight Calculator is a free online tool that computes the exact molecular weight of any RNA sequence in g/mol and kDa using validated nucleotide masses. Used by molecular biologists, biochemists, and RNA researchers to accurately size transcripts, design siRNA experiments, and verify synthetic oligonucleotide orders. Simply paste your sequence, choose single- or double-stranded RNA, and get a complete nucleotide-by-nucleotide breakdown instantly.

🧪 RNA Molecular Weight Calculator FREE TOOL
0 valid bases
Accepts .txt, .fasta, .fa files — FASTA headers removed automatically
📋 See a Worked Example ▾
Say you've in vitro transcribed a 20-nt guide RNA and want to confirm its expected mass before ordering a synthetic duplex. You paste the sequence AUGGCUAUGGCUAUGGCUAU into the box above, leave Strand Type on "Single Stranded (ssRNA)" and End Type on "5' Phosphate", then click Calculate MW. The tool reports a molecular weight of roughly 6,450 g/mol (6.45 kDa) for the 20-nt strand. If you instead select "Double Stranded (dsRNA)" to model the annealed duplex with its complementary strand, the total MW roughly doubles — this is the number to compare against the vendor's certificate of analysis for a synthetic siRNA duplex.
0
g/mol (Daltons)
0 kDa
Kilodaltons
0 nt
Sequence Length
ssRNA
Strand Type
Nucleotide Contribution Breakdown
🖨️ Print / Save Result

How to Use the RNA Molecular Weight Calculator

Step-by-Step Instructions

Step 1 — Enter your RNA sequence. Paste or type your RNA sequence into the input field. The calculator accepts standard RNA bases: A (adenine), U (uracil), G (guanine), and C (cytosine). You can paste raw sequences or FASTA-formatted input — the tool automatically removes the header line beginning with ">", as well as all whitespace, digits, and line breaks. Lowercase input is also accepted and converted automatically.

Step 2 — Select the strand type. Choose Single Stranded (ssRNA) for mRNA, lncRNA, miRNA, guide RNA, or any other single-stranded RNA molecule. Choose Double Stranded (dsRNA) for siRNA duplexes, dsRNA viral genomes, or annealed RNA duplexes. When double stranded is selected, the calculator automatically generates the complementary antisense strand (using A–U and G–C pairing) and adds its molecular weight to the total.

Step 3 — Select the end type. The 5' terminus significantly affects total molecular weight. Choose 5' Phosphate (default) for RNA produced by in vitro transcription with T7, SP6, or T3 RNA polymerases, as these produce transcripts beginning with a 5' triphosphate that is often simplified to a monophosphate. Choose 5' Hydroxyl for chemically synthesized RNA oligonucleotides, siRNAs, or any RNA where the terminal phosphate has been removed by treatment with alkaline phosphatase.

Step 4 — Click Calculate MW. Results appear immediately below the tool, showing the total molecular weight in g/mol, the equivalent mass in kilodaltons (kDa), the sequence length in nucleotides (nt), and whether the molecule is ssRNA or dsRNA. A detailed breakdown table itemizes the count, individual MW, and molar contribution of each nucleotide, as well as the water-loss correction applied for phosphodiester bonds.

The Scientific Formula Used

RNA molecular weight is calculated by summing the molecular weights of all nucleotide residues and subtracting the mass of water molecules released during phosphodiester bond formation:

MW(ssRNA) = (nA × 347.22) + (nU × 324.18) + (nG × 363.21) + (nC × 323.20) − (n − 1) × 18.02

Where nA, nU, nG, and nC are the counts of each nucleotide and n is the total sequence length. The factor (n − 1) × 18.02 subtracts water (18.02 g/mol) for each of the n−1 phosphodiester bonds formed. For dsRNA, the complement strand MW is calculated independently using the same formula and added to the sense strand value.

When to Use This Calculator

This tool is useful in a wide range of molecular biology workflows. Researchers verifying in vitro transcription products by denaturing PAGE need the expected MW to interpret gel migration. siRNA designers use it to confirm the mass of synthetic duplexes before ordering from vendors. Labs working with mRNA therapeutics require accurate molecular weight for QC documentation and dose calculations. Students learning RNA biochemistry use the nucleotide breakdown to understand how sequence composition determines molecular mass. The tool is also useful when estimating spectrophotometric extinction coefficients, as these depend on nucleotide composition.

Common Mistakes to Avoid

  • Entering a DNA sequence instead of RNA. RNA sequences use uracil (U) not thymine (T). If your sequence contains T, the calculator will flag those as invalid characters. Convert T → U before entering.
  • Forgetting to switch from 5' Phosphate to 5' Hydroxyl for synthetic oligos. Chemically synthesized RNA oligonucleotides from companies like IDT or Sigma are supplied with 5' hydroxyl ends by default. Using the wrong end type introduces an ~80 g/mol error per strand.
  • Calculating dsRNA when you only have a single strand. If you have a guide-strand siRNA sequence and select dsRNA, the tool adds a computed antisense strand — this is correct only when the duplex has fully complementary strands. Strands with mismatches or overhangs require individual ssRNA calculations for each strand.

Interpreting Your Results

The primary output is total molecular weight in g/mol, which equals Daltons (Da). For typical research applications, the kDa value is more intuitive: a 100-nucleotide ssRNA with average composition will have a molecular weight of approximately 32–33 kDa. The nucleotide breakdown table allows you to verify which bases dominate the sequence mass — high G content will increase MW due to guanosine's higher molecular weight (363.21 g/mol vs 323–347 g/mol for other bases). Use these values to cross-reference gel mobility data, confirm oligo purity certificates, or calculate the molarity of an RNA stock from its measured absorbance at 260 nm.

How RNA Molecular Weight is Calculated

The molecular weight of an RNA sequence is calculated by summing the molecular weights of all individual ribonucleotides and subtracting water molecules lost during phosphodiester bond formation. RNA uses uracil (U) instead of thymine (T), and complementary base pairing uses A–U.

// Monoisotopic MW of RNA nucleotides (5' phosphate):
AMP (Adenine) = 347.22 g/mol
UMP (Uracil) = 324.18 g/mol
GMP (Guanine) = 363.21 g/mol
CMP (Cytosine) = 323.20 g/mol

// Formula for ssRNA:
MW = (nA × 347.22) + (nU × 324.18) +
(nG × 363.21) + (nC × 323.20) - (n - 1) × 18.02

// For dsRNA — add complement strand MW using A-U pairing

Reference Molecular Weights

NucleotideBaseMW (5' Phosphate) g/molMW (5' OH) g/mol
AMPAdenine347.22267.24
UMPUracil324.18244.20
GMPGuanine363.21283.24
CMPCytosine323.20243.22

Frequently Asked Questions

What molecular weight values does this RNA calculator use for each nucleotide?

This calculator uses standard average molecular weights for RNA ribonucleotides with a 5' phosphate terminus: AMP (adenosine monophosphate) = 347.22 g/mol, UMP (uridine monophosphate) = 324.18 g/mol, GMP (guanosine monophosphate) = 363.21 g/mol, and CMP (cytidine monophosphate) = 323.20 g/mol. When the 5' hydroxyl option is selected, the values change to AMP = 267.24, UMP = 244.20, GMP = 283.24, and CMP = 243.22 g/mol respectively. These weights are derived by subtracting water from the free nucleotide mass to account for phosphodiester bond formation during polymerization.

Why is water subtracted when calculating RNA molecular weight?

When nucleotides are joined into an RNA polymer, a condensation reaction forms each phosphodiester bond and releases one water molecule (18.02 g/mol). For a sequence of n nucleotides, there are n-1 phosphodiester bonds, so the formula subtracts (n-1) × 18.02 g/mol from the sum of individual nucleotide weights. Failing to account for this water loss would systematically overestimate the molecular weight of your RNA molecule, making the correction essential for accurate results in RNA quantification and gel analysis experiments.

When should I choose 5' Phosphate vs 5' Hydroxyl end type?

Choose 5' Phosphate (the default) for RNA molecules synthesized in vitro by RNA polymerases, as these enzymes naturally produce transcripts with a 5'-triphosphate that is commonly treated to yield a 5'-monophosphate. Choose 5' Hydroxyl for RNA oligonucleotides synthesized chemically by solid-phase synthesis, siRNA duplexes produced via chemical synthesis, or any RNA where the terminal phosphate group has been enzymatically removed with a phosphatase. The difference in molecular weight between the two options is 79.98 g/mol per strand, which is the mass of one phosphate group (HPO3).

How do I calculate the molecular weight of double-stranded RNA (dsRNA)?

For double-stranded RNA, the calculator sums the molecular weight of both the sense strand you entered and its complementary antisense strand (using A–U and G–C base pairing rules). Each strand is calculated independently — summing its nucleotide weights and subtracting water for phosphodiester bonds — and the two values are then added together. This approach is used for dsRNA molecules such as siRNA duplexes, miRNA duplexes, and reovirus genomic segments. Simply select 'Double Stranded (dsRNA)' from the Strand Type dropdown before clicking Calculate MW.

Can I use this calculator for siRNA and miRNA sequences?

Yes. This calculator is fully suitable for siRNA and miRNA sequences. For siRNA duplexes, enter the guide strand sequence and select 'Double Stranded (dsRNA)' to get the combined molecular weight of both strands. For a single-stranded miRNA precursor or mature miRNA, select 'Single Stranded (ssRNA)'. Note that chemically synthesized siRNA typically uses 5' hydroxyl ends, so switch the End Type selector accordingly. The calculator also accepts FASTA-formatted input, making it convenient to paste sequences directly from databases such as miRBase or NCBI.