RNA Molecular Weight Calculator

Introduction

The RNA Molecular Weight Calculator is a free online tool that computes the exact molecular weight of any RNA sequence in g/mol and kDa using standard nucleotide masses. It is used by molecular biologists, biochemists, and RNA researchers to size transcripts, design siRNA experiments, and verify synthetic oligonucleotide orders. Paste a sequence, choose single- or double-stranded RNA, and the tool returns a complete nucleotide-by-nucleotide breakdown instantly.

About the Tool

This calculator determines the molecular weight of an RNA molecule from its base sequence alone, without requiring any laboratory measurement. It supports both single-stranded RNA (ssRNA) — such as mRNA, guide RNA, and mature miRNA — and double-stranded RNA (dsRNA), such as annealed siRNA duplexes. It also accounts for the two most common 5' terminal chemistries: the 5'-monophosphate typical of in vitro transcription products, and the 5'-hydroxyl typical of chemically synthesized oligonucleotides. Input can be pasted directly or uploaded as a plain-text or FASTA file, and results can be copied or printed for lab records.

Input Explanation

RNA sequence. Paste or type a sequence using standard RNA bases: A (adenine), U (uracil), G (guanine), and C (cytosine). Raw sequences and FASTA-formatted input are both accepted — the tool automatically strips any header line beginning with ">", along with whitespace, digits, and line breaks. Lowercase letters are converted automatically.

Strand type. Choose Single Stranded (ssRNA) for mRNA, lncRNA, miRNA, guide RNA, or any other single-stranded molecule. Choose Double Stranded (dsRNA) for siRNA duplexes, dsRNA viral genomes, or annealed duplexes; the calculator then generates the complementary antisense strand using A–U and G–C pairing and adds its weight to the total.

End type. The 5' terminus changes the total molecular weight measurably. Choose 5' Phosphate (default) for RNA produced by in vitro transcription with T7, SP6, or T3 polymerase. Choose 5' Hydroxyl for chemically synthesized oligonucleotides, siRNAs, or any RNA treated with a phosphatase to remove the terminal phosphate.

Formula Explanation

RNA molecular weight is calculated by summing the standard average molecular weight of every nucleotide residue in the sequence, then subtracting the mass of the water molecules released when each phosphodiester bond forms:

Here nA, nU, nG, and nC are the counts of each nucleotide and n is the total sequence length. The term (n − 1) × 18.02 subtracts one water molecule (18.02 g/mol) for each of the n−1 phosphodiester bonds formed during polymerization. Selecting 5' Hydroxyl subtracts one additional phosphate group (79.98 g/mol) per strand. For dsRNA, the complementary strand's weight is calculated independently with the same formula and added to the sense-strand value.

Reference Molecular Weights

Worked Example

Take the 20-nucleotide guide RNA AUGGCUAUGGCUAUGGCUAU, entered as ssRNA with a 5' phosphate end. Counting bases gives 4×A, 7×U, 6×G, and 3×C:

If this strand were instead treated as a dsRNA duplex — for example, to model an annealed synthetic siRNA — the calculator would add the independently computed weight of the complementary strand, roughly doubling the total to approximately 12,900 g/mol for the full duplex. This is the number to compare against a vendor's certificate of analysis.

Result Interpretation

The primary output is total molecular weight in g/mol, which is numerically equal to Daltons (Da). For most research purposes the kDa value is more intuitive: a 100-nucleotide ssRNA of average base composition has a molecular weight of roughly 32–33 kDa. The nucleotide breakdown table shows which bases dominate the sequence mass — a high-G sequence trends heavier, since guanosine's residue weight (363.21 g/mol) is the largest of the four. Use the reported values to cross-reference denaturing gel mobility, confirm an oligo's certificate of analysis, or convert a measured A260 absorbance reading into RNA concentration.

Practical Applications

This tool supports a range of everyday molecular biology workflows. Researchers verifying in vitro transcription products by denaturing PAGE use the expected MW to interpret gel migration. siRNA designers confirm the mass of synthetic duplexes before placing vendor orders. Labs working with mRNA therapeutics use accurate molecular weight for QC documentation and dosing calculations. Students learning RNA biochemistry use the nucleotide breakdown to see how sequence composition drives molecular mass, and the same values feed into estimating spectrophotometric extinction coefficients, which also depend on nucleotide composition.

Scientific Notes & Limitations

The values used here are standard average molecular weights for the four unmodified ribonucleotides, not monoisotopic masses — average MW is the correct basis for bulk quantities such as a stock solution, while monoisotopic mass is only relevant for interpreting mass spectrometry peaks. The calculator does not currently account for chemically modified nucleotides (such as pseudouridine, N1-methylpseudouridine, or 2'-O-methyl bases common in synthetic and therapeutic RNA), 5' cap structures (such as an m7G cap on mature mRNA), or non-standard 3' termini (such as a 2',3'-cyclic phosphate). For dsRNA mode, the complementary strand is generated assuming perfect Watson–Crick complementarity; duplexes with mismatches, overhangs, or bulges should be calculated as two independent ssRNA strands instead.

Practical Tips

• Paste sequences directly from databases such as NCBI or miRBase — FASTA headers are stripped automatically, so there is no need to clean the file first.
• Use the file upload option for longer transcripts to avoid copy-paste truncation, and double-check the reported sequence length (nt) matches what you expect.
• When comparing against a vendor's certificate of analysis, confirm whether their reported mass assumes 5' phosphate or 5' hydroxyl before comparing numbers.
• Use the Copy Result or Print/Save buttons to keep a record of a calculation alongside your experimental notes.

Common Mistakes

• Entering a DNA sequence instead of RNA. RNA sequences use uracil (U), not thymine (T). If a sequence contains T, the calculator flags it as an invalid character — convert T → U before entering.
• Forgetting to switch from 5' Phosphate to 5' Hydroxyl for synthetic oligos. Chemically synthesized RNA oligonucleotides from vendors are typically supplied with 5' hydroxyl ends by default. Using the wrong end type introduces an error of roughly 80 g/mol per strand.
• Calculating dsRNA when only one strand is known. Selecting dsRNA adds a computed antisense strand, which is only correct when the duplex is fully complementary. Strands with mismatches or overhangs should be calculated individually as ssRNA.

Frequently Asked Questions

What molecular weight values does this RNA calculator use for each nucleotide?

This calculator uses standard average molecular weights for RNA ribonucleotides with a 5' phosphate terminus: AMP (adenosine monophosphate) = 347.22 g/mol, UMP (uridine monophosphate) = 324.18 g/mol, GMP (guanosine monophosphate) = 363.21 g/mol, and CMP (cytidine monophosphate) = 323.20 g/mol. When the 5' hydroxyl option is selected, the values change to AMP = 267.24, UMP = 244.20, GMP = 283.24, and CMP = 243.22 g/mol respectively. These weights are derived by subtracting water from the free nucleotide mass to account for phosphodiester bond formation during polymerization.

Why is water subtracted when calculating RNA molecular weight?

When nucleotides are joined into an RNA polymer, a condensation reaction forms each phosphodiester bond and releases one water molecule (18.02 g/mol). For a sequence of n nucleotides, there are n-1 phosphodiester bonds, so the formula subtracts (n-1) × 18.02 g/mol from the sum of individual nucleotide weights. Failing to account for this water loss would systematically overestimate the molecular weight of your RNA molecule, making the correction essential for accurate results in RNA quantification and gel analysis experiments.

When should I choose 5' Phosphate vs 5' Hydroxyl end type?

Choose 5' Phosphate (the default) for RNA molecules synthesized in vitro by RNA polymerases, as these enzymes naturally produce transcripts with a 5'-triphosphate that is commonly treated to yield a 5'-monophosphate. Choose 5' Hydroxyl for RNA oligonucleotides synthesized chemically by solid-phase synthesis, siRNA duplexes produced via chemical synthesis, or any RNA where the terminal phosphate group has been enzymatically removed with a phosphatase. The difference in molecular weight between the two options is 79.98 g/mol per strand, which is the mass of one phosphate group (HPO3).

How do I calculate the molecular weight of double-stranded RNA (dsRNA)?

For double-stranded RNA, the calculator sums the molecular weight of both the sense strand you entered and its complementary antisense strand (using A–U and G–C base pairing rules). Each strand is calculated independently — summing its nucleotide weights and subtracting water for phosphodiester bonds — and the two values are then added together. This approach is used for dsRNA molecules such as siRNA duplexes, miRNA duplexes, and reovirus genomic segments. Simply select 'Double Stranded (dsRNA)' from the Strand Type dropdown before clicking Calculate MW.

Can I use this calculator for siRNA and miRNA sequences?

Yes. This calculator is fully suitable for siRNA and miRNA sequences. For siRNA duplexes, enter the guide strand sequence and select 'Double Stranded (dsRNA)' to get the combined molecular weight of both strands. For a single-stranded miRNA precursor or mature miRNA, select 'Single Stranded (ssRNA)'. Note that chemically synthesized siRNA typically uses 5' hydroxyl ends, so switch the End Type selector accordingly. The calculator also accepts FASTA-formatted input, making it convenient to paste sequences directly from databases such as miRBase or NCBI.

Related DNA & RNA Tools